View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16123_high_72 (Length: 202)
Name: NF16123_high_72
Description: NF16123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16123_high_72 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 16 - 194
Target Start/End: Complemental strand, 31965464 - 31965286
Alignment:
| Q |
16 |
cattttctcaaagtcttagaggtacccaactgagaatttcactatttgaattttaaagtatgaatttttattgatttctttggttgtaggaaacttttga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31965464 |
cattttctcaaagtcttagaggtacccaactgagaatttcactatttgaattttaaagtatgaatttttattgatttctttggttgtaggaaacttttga |
31965365 |
T |
|
| Q |
116 |
acgaaatgggtcatcgaggttttggcggcattttgttccttatgctgattttgtttctttgaacaagaatgatgatgtc |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31965364 |
acgaaatgggtcatcgaggttttggcggcattttgttccttatgctgattttgtttctttgaacaagaatggtgatgtc |
31965286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 19 - 194
Target Start/End: Complemental strand, 31901602 - 31901427
Alignment:
| Q |
19 |
tttctcaaagtcttagaggtacccaactgagaatttcactatttgaattttaaagtatgaatttttattgatttctttggttgtaggaaacttttgaacg |
118 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||||||||||||||||||| | |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31901602 |
tttctcaaagtcttagaggtacccaacaaaacatttcactatttgaattttaaagtttcaatttttattgatttctttgtttgtaggaaacttttgaacg |
31901503 |
T |
|
| Q |
119 |
aaatgggtcatcgaggttttggcggcattttgttccttatgctgattttgtttctttgaacaagaatgatgatgtc |
194 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||||| |
|
|
| T |
31901502 |
aaacgggtcatcgaggttttggcggcattttgttccttatgctgatttagttggtttgaacaagaatggtgatgtc |
31901427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 103 - 162
Target Start/End: Original strand, 6984291 - 6984350
Alignment:
| Q |
103 |
aggaaacttttgaacgaaatgggtcatcgaggttttggcggcattttgttccttatgctg |
162 |
Q |
| |
|
||||||| ||||| ||||||||| ||| ||||||||||| ||||||||||||||| |||| |
|
|
| T |
6984291 |
aggaaacgtttgagcgaaatggggcattgaggttttggcagcattttgttccttacgctg |
6984350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University