View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16123_low_23 (Length: 415)
Name: NF16123_low_23
Description: NF16123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16123_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 7e-62; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 132 - 256
Target Start/End: Original strand, 39922467 - 39922591
Alignment:
| Q |
132 |
tacaacactttattatcgtgtctcgatgtacattcatttagaaaccacattttctaggttctactctagtaaatttgatacaattgtgaactatgcaaat |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39922467 |
tacaacactttattatcgtgtctcgatgtacattcatttagaaaccacattttctaggttctactctagtaaatttgatacaattgtgtactatgcaaat |
39922566 |
T |
|
| Q |
232 |
ataaatgataaaaatcaattcacaa |
256 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
39922567 |
ataaatgataaaaatcaattcacaa |
39922591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 19 - 136
Target Start/End: Original strand, 39922302 - 39922419
Alignment:
| Q |
19 |
gataaccttcagcttgactctccacagtatgctattgctaagggtgaccattagcagaagcatgatcaattgatcattgatatgattattaacaggagca |
118 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39922302 |
gataaccttcagcttgactctccacggtatgctattgctaagggtgaccattagcagaagcatgatcaattgatcattgatatgattattaacaggagca |
39922401 |
T |
|
| Q |
119 |
cgattaccattactacaa |
136 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
39922402 |
cgattaccattactacaa |
39922419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 310 - 403
Target Start/End: Original strand, 39922591 - 39922684
Alignment:
| Q |
310 |
agtaaattaaggtatcttatactgtctgttatacacgcatgagcagaaactaatctctccagaaaattgatattccatttaacggttcgatatt |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39922591 |
agtaaattaaggtatcttatactgtctgttatacacgcatgagcagaaactaatctctccagaaaattgatattccatttaacggttcgatatt |
39922684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University