View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16123_low_29 (Length: 357)
Name: NF16123_low_29
Description: NF16123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16123_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 319; Significance: 1e-180; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 11 - 341
Target Start/End: Complemental strand, 43560309 - 43559979
Alignment:
| Q |
11 |
catagggaagacgtaactgcagcttctggaatgccaaaggaattactgcagccttgcaagctttcactgccagcagcttttgattcagatttttcacaag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43560309 |
catagggaagacgtaactgcagcttctggaatgccaaaggaattactgcagcctcgcaagctttcactgccagcagcttttgattcagatttttcacaag |
43560210 |
T |
 |
| Q |
111 |
ttgatttcaaagcaacattcaggccactggagaccggttcagtcacaaaactgtaacataaaaaataaagcaagcacaactcaggtttcaaataactagg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43560209 |
ttgatttcaaagcaacattcaggccactggagaccggttcagtcagaaaactgtaacataaaaaataaagcaagcacaactcaggtttcaaataactagg |
43560110 |
T |
 |
| Q |
211 |
taaggcgattccagttttaattcaatggcgtgcgcagtcaaacgtgtccagaagctcatgaaattctacttgagctcatcgcaactcaagactaatcagc |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43560109 |
taaggcgattccagttttaattcaatggcgtgcgcagtcaaacgtgtccagaagctcatgaaattctacttgagctcatcgcaactcaagactaatcagc |
43560010 |
T |
 |
| Q |
311 |
aggttagcacaatgaagtgtcactgtgaaag |
341 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |
|
|
| T |
43560009 |
aggttagcacaatgaagtgtcactgagaaag |
43559979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 10689139 - 10689197
Alignment:
| Q |
104 |
tcacaagttgatttcaaagcaacattcaggccactggagaccggttcagtcacaaaact |
162 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||| | |||| ||||||||||||||||| |
|
|
| T |
10689139 |
tcacaaattgatttcaaagcaacattgaggccaattgagagtggttcagtcacaaaact |
10689197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University