View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16123_low_39 (Length: 327)
Name: NF16123_low_39
Description: NF16123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16123_low_39 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 56 - 310
Target Start/End: Original strand, 4443634 - 4443884
Alignment:
| Q |
56 |
aaaagattgtgaatttgaagtattgattgatttgttactgcttccacacacctacttctcatgtattactttctcttatttatgcttatagtgacgggga |
155 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4443634 |
aaaagattgtgaatttgaagtaatgatt----tgttattgcttccacacacctacttctaatgtattactttctcttatttatgcttatagtgacgggga |
4443729 |
T |
|
| Q |
156 |
atgataccttgaaagaaaagttgattattcacatcacacaacgtggcatgtttctttggccagctagtcttgcagatccttgccacgttttgtattgccg |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4443730 |
atgataccttgaaagaaaagttgattattcacatcacactacgtggcatgtttctctggccagctagtcttgcagatccttgccacgttttgtattgccg |
4443829 |
T |
|
| Q |
256 |
acctcgagggtgcctactttgcattgttgaatgctaagtgtgcggtcctgtgcat |
310 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4443830 |
acctcgaggctgcctactttgcattgttgaatgctaagtgtgcggtcctgtgcat |
4443884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University