View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16123_low_46 (Length: 300)
Name: NF16123_low_46
Description: NF16123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16123_low_46 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 10 - 244
Target Start/End: Original strand, 40615715 - 40615949
Alignment:
| Q |
10 |
catcatcattatgttataatgtttacaatgccttttcattttcaccaacaactagagtattcccttttatgttaaagccatcatcatctttcagatgctt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40615715 |
catcatcattatgttataatgtttacaatgccttttcattttcaccaacaactagagtattcccttttatgttaaagccatcatcatctttcagatgctc |
40615814 |
T |
 |
| Q |
110 |
ctcctcttcctccatcactactactaattccactccatcctacaattcccttgtttatgaggtttcttccccctttctctgaatatgatgctagatttat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40615815 |
ctcctcttcctccatcactactactaattccactccatcctacaattcccttgtttatgaggtttcttccccctttctctgaatatgatgctagatttat |
40615914 |
T |
 |
| Q |
210 |
cattttctttccttacagtaaaacaatatgcacct |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
40615915 |
cattttctttccttacagtaaaacaatatgcacct |
40615949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University