View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16123_low_66 (Length: 251)
Name: NF16123_low_66
Description: NF16123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16123_low_66 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 13 - 251
Target Start/End: Original strand, 41150574 - 41150813
Alignment:
| Q |
13 |
tgaaggtgatccagattgtccctctaaagggtactcttccattgagcatgccctaaatgcgttacaccaaggaaaggttagttagaattttacctttgtt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41150574 |
tgaaggtgatccagattgtccctctaaaggatactcttccattgagcatgccctaaatgcgttacaccaaggaaaggttagttagaattttacctttgtt |
41150673 |
T |
 |
| Q |
113 |
cgttatgtctaatacatgtttggaatcacggtgattctaacaaaatcatagtagcacgatgacttcgataaaatacaaaaatgcaactttgatc-aaatc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
41150674 |
cgttatgtctaatacatgtttggaatcacgatgattctaataaaatcatagtagcacgatgacttcgttaaaatacaaaaatgcaactttgatcaaaatc |
41150773 |
T |
 |
| Q |
212 |
acattgacactaacacgtattgtgacaaaatcaccgtcaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41150774 |
acattgacactaacacgtattgtgacaaaatcaccgtcaa |
41150813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 169
Target Start/End: Original strand, 46090025 - 46090067
Alignment:
| Q |
127 |
catgtttggaatcacggtgattctaacaaaatcatagtagcac |
169 |
Q |
| |
|
|||||||||||||||||| | | |||||||||||||||||||| |
|
|
| T |
46090025 |
catgtttggaatcacggtaaatttaacaaaatcatagtagcac |
46090067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University