View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16123_low_70 (Length: 249)
Name: NF16123_low_70
Description: NF16123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16123_low_70 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 237
Target Start/End: Original strand, 33318538 - 33318757
Alignment:
| Q |
18 |
ctttcatatatcaatttgcatggtttactaagaagttggtcccctcaatgccaaattgtgatgttagctgttattgtggatttggtgattataatttgat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33318538 |
ctttcatatatcaatttgcatggtttactaagaagttggtcacctcaatgccaaattgtgatgttagctgttattgtggatttggtgattataatttgat |
33318637 |
T |
|
| Q |
118 |
attgttgtaacaaaaacacgtttggcaacaaatatgttaattgcaactttgctaataatattgctgaatttgtcattttgaaatatttttcagttaatat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33318638 |
attgttgtaacaaaaacacgtttggcaacagatatgttaattgcaactttgctaataatgttgctgaatttgtcattttgaaatccttttcagttaatat |
33318737 |
T |
|
| Q |
218 |
taatgttgtttattcttctc |
237 |
Q |
| |
|
| |||||||||||||||||| |
|
|
| T |
33318738 |
tcatgttgtttattcttctc |
33318757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University