View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16123_low_73 (Length: 243)

Name: NF16123_low_73
Description: NF16123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16123_low_73
NF16123_low_73
[»] chr8 (2 HSPs)
chr8 (19-104)||(30667430-30667515)
chr8 (168-224)||(30667579-30667635)


Alignment Details
Target: chr8 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 19 - 104
Target Start/End: Original strand, 30667430 - 30667515
Alignment:
19 atatcatggtctaaggtagggtaaagtggtcatggaattggtgtaatgttctaatttctcttcccctctgattttctcggaattcc 104  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30667430 atatcatggtctaaggtagggtaaagttgtcatggaattggtgtaatgttctaatttctcttcccctctgattttctcggaattcc 30667515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 168 - 224
Target Start/End: Original strand, 30667579 - 30667635
Alignment:
168 attgtactaccttctagtctatctactataagttgagaattatgctttacaattgat 224  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30667579 attgtactaccttctagtctatctactataagttgagaattatgctttacaattgat 30667635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University