View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16123_low_78 (Length: 217)
Name: NF16123_low_78
Description: NF16123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16123_low_78 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 15 - 199
Target Start/End: Complemental strand, 44155552 - 44155368
Alignment:
| Q |
15 |
agaggttggttagccaaattagtagttttatgaggagagtgagtttatttttattaaagnnnnnnngtgtgccctttgcatgagttggtttgcacctaat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
44155552 |
agaggttggttagccaaattagtagttttatgaggagagtgagtttatttttattaaagaaaaaaagtgtgccctttgcatgagttggtttgcacctaat |
44155453 |
T |
 |
| Q |
115 |
acgcttagtgtcttgcttaaccacttcaatcagtagcttggatgagtgataggtggcttatatctttctattcgcatgcatgaat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44155452 |
acgcttagtgtcttgcttaaccacttcaatcagtagcttggatgagtgataggtggcttatatctttctattcgcatgcatgaat |
44155368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University