View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16123_low_78 (Length: 217)

Name: NF16123_low_78
Description: NF16123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16123_low_78
NF16123_low_78
[»] chr1 (1 HSPs)
chr1 (15-199)||(44155368-44155552)


Alignment Details
Target: chr1 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 15 - 199
Target Start/End: Complemental strand, 44155552 - 44155368
Alignment:
15 agaggttggttagccaaattagtagttttatgaggagagtgagtttatttttattaaagnnnnnnngtgtgccctttgcatgagttggtttgcacctaat 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||    
44155552 agaggttggttagccaaattagtagttttatgaggagagtgagtttatttttattaaagaaaaaaagtgtgccctttgcatgagttggtttgcacctaat 44155453  T
115 acgcttagtgtcttgcttaaccacttcaatcagtagcttggatgagtgataggtggcttatatctttctattcgcatgcatgaat 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44155452 acgcttagtgtcttgcttaaccacttcaatcagtagcttggatgagtgataggtggcttatatctttctattcgcatgcatgaat 44155368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University