View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16123_low_79 (Length: 212)
Name: NF16123_low_79
Description: NF16123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16123_low_79 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 11 - 196
Target Start/End: Complemental strand, 330025 - 329840
Alignment:
| Q |
11 |
gtgagatgaatattaaactaatgtgatagctatagactcttctactgtagaggataggaatggtgtttgcatagaaatatgaataataataataattatc |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
330025 |
gtgaaatgaatattaaactaatgtgatagctatagactcttctactgtagaggataggaatggtgtttgcatagaaatatgaataataataataattatc |
329926 |
T |
|
| Q |
111 |
aatctcctccatcttctacacagcatgctgaacttgatttgtgtgctccggttgattatccaatggcatgtattgggccattattg |
196 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
329925 |
aatctccttcatcttctacacagcatgctgaacttgatttgtgtgctccggttgattatccaatggcatgtattgggccattattg |
329840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University