View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16123_low_80 (Length: 205)
Name: NF16123_low_80
Description: NF16123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16123_low_80 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 4e-68; HSPs: 7)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 3579089 - 3579275
Alignment:
| Q |
1 |
aaggaccgtgggatttatggtgaggtgatggagcgcgtgatggcgagtgacggtgaggggagggaccatgagagttgtggtgaggggatggagcttgtga |
100 |
Q |
| |
|
||||||| || |||||||| | ||||||||||||| ||||||| |||||||||||| |||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
3579089 |
aaggaccatgagatttatgataaggtgatggagcgaatgatggcaagtgacggtgagaagagggaccatgagattgatggtgaggggatggagcttgtga |
3579188 |
T |
 |
| Q |
101 |
tggtgagtgatgggggtggtgaggggaatgagcaggagattggtggtgaggggcaggagcagatgatggtttgtgacgggttataaa |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3579189 |
tggtgagtgatgggggtggtgaggggaatgagcaggagattggtggtgacgggaaggagcagatgatggtttgtgacgggttataaa |
3579275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 59 - 158
Target Start/End: Original strand, 3578998 - 3579093
Alignment:
| Q |
59 |
ggagggaccatgagagttgtggtgaggggatggagcttgtgatggtgagtgatgggggtggtgaggggaatgagcaggagattggtggtgaggggcagga |
158 |
Q |
| |
|
||||||||||||||| | |||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3578998 |
ggagggaccatgagattggtggtgagggga----gcttgtgatggtgagtgatgagggtggtgaggggaatgagcaggagattggtggtgaggggaagga |
3579093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 78 - 187
Target Start/End: Original strand, 3549296 - 3549405
Alignment:
| Q |
78 |
tggtgaggggatggagcttgtgatggtgagtgatgggggtggtgaggggaatgagcaggagattggtggtgaggggcaggagcagatgatggtttgtgac |
177 |
Q |
| |
|
|||||| |||||||| | |||||||| ||||||||| ||||||||| |||||||||||||| | |||||||||||| | ||||||||||||||||||||| |
|
|
| T |
3549296 |
tggtgatgggatggaccatgtgatggcgagtgatggtggtggtgagaggaatgagcaggaggtcggtggtgaggggaatgagcagatgatggtttgtgac |
3549395 |
T |
 |
| Q |
178 |
gggttataaa |
187 |
Q |
| |
|
|| ||||||| |
|
|
| T |
3549396 |
ggcttataaa |
3549405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 141 - 187
Target Start/End: Original strand, 3545609 - 3545655
Alignment:
| Q |
141 |
tggtggtgaggggcaggagcagatgatggtttgtgacgggttataaa |
187 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
3545609 |
tggtggtgaggggaatgagcagatgatggtttgtgacgggttataaa |
3545655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 9 - 70
Target Start/End: Original strand, 3545531 - 3545592
Alignment:
| Q |
9 |
tgggatttatggtgaggtgatggagcgcgtgatggcgagtgacggtgaggggagggaccatg |
70 |
Q |
| |
|
||||||||||||||| | ||||||||| ||||||| |||||| ||||| ||||||||||||| |
|
|
| T |
3545531 |
tgggatttatggtgatgagatggagcgggtgatggtgagtgatggtgatgggagggaccatg |
3545592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 78 - 135
Target Start/End: Original strand, 3545573 - 3545630
Alignment:
| Q |
78 |
tggtgaggggatggagcttgtgatggtgagtgatgggggtggtgaggggaatgagcag |
135 |
Q |
| |
|
|||||| |||| ||| | |||||||| ||| ||||| ||||||||||||||||||||| |
|
|
| T |
3545573 |
tggtgatgggagggaccatgtgatggcgagcgatggtggtggtgaggggaatgagcag |
3545630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 97 - 153
Target Start/End: Original strand, 3548883 - 3548939
Alignment:
| Q |
97 |
gtgatggtgagtgatgggggtggtgaggggaatgagcaggagattggtggtgagggg |
153 |
Q |
| |
|
||||||||||||| ||| ||||| |||| ||| ||||| ||||||| |||||||||| |
|
|
| T |
3548883 |
gtgatggtgagtgctggtggtggcgaggagaaggagcatgagattgatggtgagggg |
3548939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 105 - 153
Target Start/End: Complemental strand, 5342263 - 5342215
Alignment:
| Q |
105 |
gagtgatgggggtggtgaggggaatgagcaggagattggtggtgagggg |
153 |
Q |
| |
|
||||||||| |||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
5342263 |
gagtgatggtggtggtgaggagaacgagcaggagattggtggtgagggg |
5342215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 77 - 153
Target Start/End: Complemental strand, 25222781 - 25222705
Alignment:
| Q |
77 |
gtggtgaggggatggagcttgtgatggtgagtgatgggggtggtgaggggaatgagcaggagattggtggtgagggg |
153 |
Q |
| |
|
|||||||||||| |||| ||||||| ||||||||| |||||||||| ||| |||| |||||||||||||||||| |
|
|
| T |
25222781 |
gtggtgaggggaaggagagggtgatggcgagtgatggtggtggtgaggagaaggagcgagagattggtggtgagggg |
25222705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 96 - 176
Target Start/End: Complemental strand, 25222543 - 25222463
Alignment:
| Q |
96 |
tgtgatggtgagtgatgggggtggtgaggggaatgagcaggagattggtggtgaggggcaggagcagatgatggtttgtga |
176 |
Q |
| |
|
||||||||||||||| || | |||||||||||| | || |||||| ||||||| ||| | ||||| ||||||||||||| |
|
|
| T |
25222543 |
tgtgatggtgagtgaaggtgatggtgaggggaaggtgcgagagattcgtggtgaagggaatgagcatgtgatggtttgtga |
25222463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 77 - 147
Target Start/End: Original strand, 38542464 - 38542534
Alignment:
| Q |
77 |
gtggtgaggggatggagcttgtgatggtgagtgatgggggtggtgaggggaatgagcaggagattggtggt |
147 |
Q |
| |
|
||||||| |||| |||||| |||||||||||||| | |||||||||||||| || ||||||||||||| |
|
|
| T |
38542464 |
gtggtgacgggagggagctggtgatggtgagtgaaagtggtggtgaggggaagacgcgggagattggtggt |
38542534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University