View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16124_high_30 (Length: 324)
Name: NF16124_high_30
Description: NF16124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16124_high_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 1 - 309
Target Start/End: Original strand, 41022344 - 41022652
Alignment:
| Q |
1 |
aaatggggcgaaaaaccactagtctggtataactccatgaaacattcgatgatatactcatgcatgatggtaatgtcaaaaagttggtcagtcaatccat |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
41022344 |
aaatggggcgaaaaaccactattctggtataactccatgaaacattcgatgatatactcatgcatgatggtactgtcaaaaaattggtcagtcaatccat |
41022443 |
T |
|
| Q |
101 |
tcacttcatcaaaagtggatgaagaatccatcaataagtttgataaatggctcttcataggttcatcacatttcaagctgaaagtctgcagaacttcact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41022444 |
tcacttcatcaaaagtggatgaagaatccatcaataagtttgataaatggctcttcataggttcatcacatttcaagctgaaagtctgcagaacttcact |
41022543 |
T |
|
| Q |
201 |
tatgatatcctttgagttgttcattggatccaaagaggatgttataaggtcttcaagatgtttctcttcaaatctatcataatcaacttgtaccagtgac |
300 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41022544 |
tatgatatcctttgacttgttcattggatccaaagaggatgttataaggtcttcaagctgtttctcttcaaatctatcataatcaacttgtaccagtgac |
41022643 |
T |
|
| Q |
301 |
ccatctgtt |
309 |
Q |
| |
|
||||||||| |
|
|
| T |
41022644 |
ccatctgtt |
41022652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University