View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16124_high_34 (Length: 295)
Name: NF16124_high_34
Description: NF16124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16124_high_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 8869224 - 8869033
Alignment:
| Q |
1 |
gttagcgcagactaacacatgatagtgaatgcatccataatattagctcaaacttttggtgctgggatcctattgaatga----ttgttgaggaattgga |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8869224 |
gttagcgcagactaacacatgatagtgaatgcatccataatattagctcaaacttttggtgctgggatcctattgaatgaatgattgttgaggaattgga |
8869125 |
T |
 |
| Q |
97 |
aaggctattttatcatgagtgatgagaattggcctactacttttgttatcactctggactgtctttggatgtccatcattcacggtcgagct |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8869124 |
aaggctattttatcatgagtgatgagaattggcttactacttttgttatcactctggactgtctttggatggccatcattcacggtcgagct |
8869033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 8869034 - 8868979
Alignment:
| Q |
223 |
ctaccattaatattctagtttgttttccaggaagatgccgagtcaagggattttta |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8869034 |
ctaccattaatattctagtttgttttccaggaagatgctgagtcaagggattttta |
8868979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University