View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16124_high_40 (Length: 268)
Name: NF16124_high_40
Description: NF16124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16124_high_40 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 16 - 258
Target Start/End: Original strand, 43219980 - 43220222
Alignment:
| Q |
16 |
acaagagtatgactaaaatatttttgaaatagttactgccnnnnnnngttacttccttgtatatggaagcaagtgaaacacattgcgtaatagtaaaatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43219980 |
acaagagtatgactaaaatatttttgaaatagttactgccaaaaaaggttactccattgtatatggaagcaagtgaaacacattgcgtaatagtaaaatt |
43220079 |
T |
|
| Q |
116 |
gaaacgcattgtgcaattgtaaaacgaccattagtaccgcttattaattnnnnnnnctcattgcaaaatactagtaaaaatttcaaacttctaagttttt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43220080 |
gaaacgcattgtgcaattgtaaaacgaccattagtaccgcttattaattaaaaaaactcattgcaaaatactagtaaaaatttcaaacttctaagttttt |
43220179 |
T |
|
| Q |
216 |
ctctattctcattctttcttgcacctatcaccagaataattta |
258 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43220180 |
ctctattctcattctttcttgcacccatcaccagaataattta |
43220222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University