View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16124_low_24 (Length: 377)
Name: NF16124_low_24
Description: NF16124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16124_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 16 - 356
Target Start/End: Original strand, 54958583 - 54958923
Alignment:
| Q |
16 |
aagaaggtagctcaattataaactcaacctcagtgaatgcctacacaggtaaagcagaaacactcgactacacatcgacgaaaggagccattgttgcatt |
115 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54958583 |
aagaaggtagctcaatcataaactcaacctcagtgaatgcctacacaggtaaagcagaaacactcgactacacatcgacgaaaggagccattgttgcatt |
54958682 |
T |
|
| Q |
116 |
cactagaggtcttgctcagcagttggtgagaaagggaataagagtgaatggtgttgcaccaggaccaatttggacgccagttcaaccagctactatgact |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
54958683 |
cactagaggtcttgctcagcagttggtgagcaagggaataagagtgaatgctgttgctccaggaccaatttggacgccagttcaaccagctactatgcct |
54958782 |
T |
|
| Q |
216 |
tatgagaagatacagaatttggggtcagatgtgccaatgaaacgagcaggtcagccttgtgagattgcaccttgttatttgttcttggcttctcttcagg |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
54958783 |
tatgagaagatacagaatttggggtcagatgtgccaatgaaacgagcaggtcagccttgtgagattgcaccttgttatttattcttggcttctctacagg |
54958882 |
T |
|
| Q |
316 |
actcttcttactttactggtcaagtcctccatccaaatggt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54958883 |
actcttcttactttactggtcaagtcctccatccaaatggt |
54958923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University