View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16124_low_29 (Length: 352)

Name: NF16124_low_29
Description: NF16124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16124_low_29
NF16124_low_29
[»] scaffold0054 (1 HSPs)
scaffold0054 (18-334)||(43738-44054)
[»] chr6 (2 HSPs)
chr6 (196-282)||(24416432-24416519)
chr6 (57-121)||(12155603-12155667)
[»] chr7 (2 HSPs)
chr7 (78-176)||(45627659-45627756)
chr7 (78-176)||(30783839-30783936)
[»] chr5 (2 HSPs)
chr5 (110-176)||(31183566-31183630)
chr5 (121-176)||(22070172-22070228)
[»] chr4 (1 HSPs)
chr4 (132-176)||(3499072-3499116)
[»] scaffold0209 (1 HSPs)
scaffold0209 (121-176)||(15215-15270)
[»] scaffold0028 (1 HSPs)
scaffold0028 (121-176)||(20741-20796)
[»] chr2 (6 HSPs)
chr2 (115-176)||(30054041-30054102)
chr2 (115-176)||(30145084-30145145)
chr2 (109-151)||(17708946-17708988)
chr2 (57-98)||(17708948-17708989)
chr2 (61-98)||(30054038-30054075)
chr2 (61-98)||(30145081-30145118)
[»] chr1 (1 HSPs)
chr1 (57-108)||(9322861-9322912)
[»] scaffold0264 (1 HSPs)
scaffold0264 (57-98)||(24087-24128)


Alignment Details
Target: scaffold0054 (Bit Score: 305; Significance: 1e-171; HSPs: 1)
Name: scaffold0054
Description:

Target: scaffold0054; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 18 - 334
Target Start/End: Complemental strand, 44054 - 43738
Alignment:
18 gagattgagcgaggggtttgcgattgagattgtgccagcggtggtagagatttaggttttaatttggggggaagtgagattatgggtgagtgtggtggag 117  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44054 gagattgagccaggggtttgcgattgagattgtgccagcggtggtagagatttaggttttaatttggggggaagtgagattatgggtgagtgtggtggag 43955  T
118 atttaggtttcagattgagggaaagtgagattgaggaataaaattgggttttagggtttcataaattggctcatgagtcatgacagactttcataaattg 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43954 atttaggtttcagattgagggaaagtgagattgaggaataaaattgggttttagggtttcataaattggctcatgagtcatgacagactttcataaattg 43855  T
218 gtattgcctgaacttcatctgattctaatcaacagaatcacatgagtccagttacggaaagcttctttaaaaccaaatcagtagctagtagctacagata 317  Q
    |||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43854 gtattgcctgaacttcatctgattctaatcaatagaatcacatgaatccagttacggaaagcttctttaaaaccaaatcagtagctagtagctacagata 43755  T
318 gacaatctttgatgttc 334  Q
    |||||||||||||||||    
43754 gacaatctttgatgttc 43738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 56; Significance: 4e-23; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 196 - 282
Target Start/End: Complemental strand, 24416519 - 24416432
Alignment:
196 catgacagactttcataaattggtatt-gcctgaacttcatctgattctaatcaacagaatcacatgagtccagttacggaaagcttc 282  Q
    ||||||||||||| ||||||||||||| |  |||||||||| |||||||||||||||||||||||| | |||||||||||||||||||    
24416519 catgacagacttttataaattggtatttggttgaacttcatatgattctaatcaacagaatcacataaatccagttacggaaagcttc 24416432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 57 - 121
Target Start/End: Original strand, 12155603 - 12155667
Alignment:
57 ggtggtagagatttaggttttaatttggggggaagtgagattatgggtgagtgtggtggagattt 121  Q
    |||| |||||||| |||||| ||| |||||| |||||||||| ||||| || |||||||||||||    
12155603 ggtgatagagattaaggtttcaatctgggggaaagtgagattgtgggtaagagtggtggagattt 12155667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 51; Significance: 4e-20; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 78 - 176
Target Start/End: Complemental strand, 45627756 - 45627659
Alignment:
78 aatttggggggaagtgagattatgggtgagtgtggtggagatttaggtttcagattgagggaaagtgagattgaggaataaaattgggttttagggttt 176  Q
    |||||||||| ||||| |||| |||||||| |||||||| |||||||| |||||||| |||||| ||| ||||| |||||||||||| |||||||||||    
45627756 aatttgggggaaagtg-gattgtgggtgagagtggtggaaatttaggtgtcagattgggggaaaatgaaattgatgaataaaattggattttagggttt 45627659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 78 - 176
Target Start/End: Complemental strand, 30783936 - 30783839
Alignment:
78 aatttggggggaagtgagattatgggtgagtgtggtggagatttaggtttcagattgagggaaagtgagattgaggaataaaattgggttttagggttt 176  Q
    |||||||||| ||||| |||| |||||||| | |||||| |||||||| | |||||| | |||||||| ||||| |||||||||||| |||||||||||    
30783936 aatttgggggaaagtg-gattgtgggtgagagaggtggaaatttaggtgtgagattgggcgaaagtgaaattgatgaataaaattggattttagggttt 30783839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 47; Significance: 9e-18; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 110 - 176
Target Start/End: Complemental strand, 31183630 - 31183566
Alignment:
110 tggtggagatttaggtttcagattgagggaaagtgagattgaggaataaaattgggttttagggttt 176  Q
    |||| |||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||    
31183630 tggtagagatttaggtttcagattg-gggaaagtgagattgag-aataaaattgggttttagggttt 31183566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 121 - 176
Target Start/End: Original strand, 22070172 - 22070228
Alignment:
121 taggtttcagattgagggaaagtgagattg-aggaataaaattgggttttagggttt 176  Q
    |||||||||||||||| ||||||||||||| |  || |||||| |||||||||||||    
22070172 taggtttcagattgagagaaagtgagattgaaaaaaaaaaattaggttttagggttt 22070228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 132 - 176
Target Start/End: Original strand, 3499072 - 3499116
Alignment:
132 ttgagggaaagtgagattgaggaataaaattgggttttagggttt 176  Q
    |||||||||||||||||||||||||||||| ||||||||||||||    
3499072 ttgagggaaagtgagattgaggaataaaatggggttttagggttt 3499116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0209 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0209
Description:

Target: scaffold0209; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 121 - 176
Target Start/End: Complemental strand, 15270 - 15215
Alignment:
121 taggtttcagattgagggaaagtgagattgaggaataaaattgggttttagggttt 176  Q
    |||||||||||||||| |||||||||||||| ||| |||||| |||||||||||||    
15270 taggtttcagattgagagaaagtgagattgaagaaaaaaattaggttttagggttt 15215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0028 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0028
Description:

Target: scaffold0028; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 121 - 176
Target Start/End: Original strand, 20741 - 20796
Alignment:
121 taggtttcagattgagggaaagtgagattgaggaataaaattgggttttagggttt 176  Q
    |||||||||||||||| |||||||||||||| ||| |||||| |||||||||||||    
20741 taggtttcagattgagagaaagtgagattgaagaaaaaaattaggttttagggttt 20796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 38; Significance: 0.000000000002; HSPs: 6)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 115 - 176
Target Start/End: Original strand, 30054041 - 30054102
Alignment:
115 gagatttaggtttcagattgagggaaagtgagattgaggaataaaattgggttttagggttt 176  Q
    ||||||||||||| |  ||| |||||||| |||||| |||||||||||||||||||||||||    
30054041 gagatttaggttttaatttgggggaaagttagattgtggaataaaattgggttttagggttt 30054102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 115 - 176
Target Start/End: Original strand, 30145084 - 30145145
Alignment:
115 gagatttaggtttcagattgagggaaagtgagattgaggaataaaattgggttttagggttt 176  Q
    ||||||||||||| |  ||| |||||||| |||||| |||||||||||||||||||||||||    
30145084 gagatttaggttttaatttgggggaaagttagattgtggaataaaattgggttttagggttt 30145145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 109 - 151
Target Start/End: Complemental strand, 17708988 - 17708946
Alignment:
109 gtggtggagatttaggtttcagattgagggaaagtgagattga 151  Q
    ||||| ||||||||||||||| |||| ||||||||||||||||    
17708988 gtggtagagatttaggtttcaaattgggggaaagtgagattga 17708946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 57 - 98
Target Start/End: Complemental strand, 17708989 - 17708948
Alignment:
57 ggtggtagagatttaggttttaatttggggggaagtgagatt 98  Q
    |||||||||||||||||||| || ||||||| ||||||||||    
17708989 ggtggtagagatttaggtttcaaattgggggaaagtgagatt 17708948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 61 - 98
Target Start/End: Original strand, 30054038 - 30054075
Alignment:
61 gtagagatttaggttttaatttggggggaagtgagatt 98  Q
    ||||||||||||||||||||||||||| |||| |||||    
30054038 gtagagatttaggttttaatttgggggaaagttagatt 30054075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 61 - 98
Target Start/End: Original strand, 30145081 - 30145118
Alignment:
61 gtagagatttaggttttaatttggggggaagtgagatt 98  Q
    ||||||||||||||||||||||||||| |||| |||||    
30145081 gtagagatttaggttttaatttgggggaaagttagatt 30145118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 57 - 108
Target Start/End: Complemental strand, 9322912 - 9322861
Alignment:
57 ggtggtagagatttaggttttaatttggggggaagtgagattatgggtgagt 108  Q
    ||||||||||||| |||||| |||||||||| |||||||||| |||||||||    
9322912 ggtggtagagattaaggtttcaatttgggggaaagtgagattgtgggtgagt 9322861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0264 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0264
Description:

Target: scaffold0264; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 57 - 98
Target Start/End: Complemental strand, 24128 - 24087
Alignment:
57 ggtggtagagatttaggttttaatttggggggaagtgagatt 98  Q
    |||||||||||||||||||| |||||||| ||||||||||||    
24128 ggtggtagagatttaggtttcaatttgggaggaagtgagatt 24087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University