View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16124_low_32 (Length: 334)
Name: NF16124_low_32
Description: NF16124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16124_low_32 |
 | |
|
| [»] scaffold0140 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0140 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 14 - 316
Target Start/End: Original strand, 18709 - 19010
Alignment:
| Q |
14 |
cctgtgaaattgggttacaaaa-ctttcggctcttctttggagttgttcgattatttcaacagttttcttcatgcttggggtcctaatcttaatgttaac |
112 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18709 |
cctgtgaaattgggttacaaaaactttcggctcttctttggagttgttcgattatttcaacagttttcttcatgcttggggtcctaatcttaatgttaac |
18808 |
T |
|
| Q |
113 |
aaggttagcaattcgtctatctaattacttatcacttttgcattatcccataaattgacattattttgatgttaatgatattatgttaattgtgcattga |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
18809 |
aaggttagcaattcgtctatctaattacttatcacttttgcattatcccttaaattgacattattttgatgttaatgatattatgttgtgggtgatttga |
18908 |
T |
|
| Q |
213 |
tgttagttgtgcctgttttgtttggaacagtttagctttatacatttaagtcatttagtttctagagcttcagagttcaacccttcagtagtattgatgt |
312 |
Q |
| |
|
| | ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18909 |
--gtcttcgtgcctgttttgtttggaacattttagctttatacatttaagtcatttagtttctagagcttcagagttcaaccctttagtagtattgatgt |
19006 |
T |
|
| Q |
313 |
gaag |
316 |
Q |
| |
|
|||| |
|
|
| T |
19007 |
gaag |
19010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University