View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16124_low_59 (Length: 215)
Name: NF16124_low_59
Description: NF16124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16124_low_59 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 28267749 - 28267954
Alignment:
| Q |
1 |
catagcacttctactaattgatgaagtccatctgctgaatgatccacgtggagctgtgctggaagcaattgttagcagaataaaaattatttcttgcaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28267749 |
catagcacttctactaattgatgaagtccatctgctgaatgatccacgtggagctgcgctggaagcaattgttagcagaataaaaattatttcttgcaat |
28267848 |
T |
|
| Q |
101 |
ccaaaaatgaaattaaatcctctggctcaggtccgcttccttgctttatcagcaacaattccaaatattgaggatctaggtattttctttttcacttgat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28267849 |
ccaaaaatgaaattaaatcctctggctcaggtccgcttcctcgctttatcagcaacaattccaaatattgaggatctaggtattttctttttcacttgat |
28267948 |
T |
|
| Q |
201 |
gatgtc |
206 |
Q |
| |
|
| |||| |
|
|
| T |
28267949 |
gttgtc |
28267954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University