View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16124_low_61 (Length: 201)
Name: NF16124_low_61
Description: NF16124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16124_low_61 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 16 - 185
Target Start/End: Complemental strand, 16688134 - 16687965
Alignment:
| Q |
16 |
tgagaagaagcaacattgacgtcgcagaatgcgacgggagagaggatggtgtcagcttaactctaaagagtatggatcccaaaggaagagccacgactat |
115 |
Q |
| |
|
|||||||||||||||| |||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16688134 |
tgagaagaagcaacatcgacgtccccttctgcgacgggagagaggatggtgtcagcttaactctaaagagtatggatcccaaaggaagagccacgactat |
16688035 |
T |
|
| Q |
116 |
gttgtagctttcatcagtggttttcttagcacaaggtgaatgagagagcgtagcaaaaaatggttatgga |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
16688034 |
gttgtagctttcatcagtggttttcttagcacaaggtgaacgagagagcgtagcaaaaaatggttatgga |
16687965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University