View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16125_low_2 (Length: 425)
Name: NF16125_low_2
Description: NF16125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16125_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 275; Significance: 1e-154; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 1 - 279
Target Start/End: Original strand, 36538742 - 36539020
Alignment:
| Q |
1 |
tcaaaaggcaatttcttcaatagtttcactccaattacccaatattgaaaagggtacaagaattccaatgttgggtagtgtttactttgtgctttctaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36538742 |
tcaaaaggcaatttcttcaatagtttcactccaattacccaatattgaaaagggtacaagaattccaatgttgggtagtgtttactttgtgctttctaat |
36538841 |
T |
 |
| Q |
101 |
atcacaatatatgaaattgatgttgattcttctaatgtcaagcctggtgagaatggaattgagattttagcttctggggttagttgtaatatgagtttgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36538842 |
atcacaatatatgaaattgatgttgattcttctaatgtcaagcctggtgagaatggaattgagattttagcttctggggttagttgtaatatgagtttgg |
36538941 |
T |
 |
| Q |
201 |
attggtcttatgagtatagtagtatttggtttggtcctgttaaggtttctgatcaaggttcagcacaagtgcaggtatg |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36538942 |
attggtcttatgagtatagtagtatttggtttggtcctgttaaggtttctgatcaaggttcagcacaagttcaggtatg |
36539020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 355 - 408
Target Start/End: Original strand, 36539096 - 36539149
Alignment:
| Q |
355 |
gaaaaattgtgttgctaatagaaacataatctatttatgattgtggtttaggcc |
408 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36539096 |
gaaaaattgtgttgctaatagaaacataatctatttatgattgtggtttaggcc |
36539149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University