View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16126_high_4 (Length: 282)
Name: NF16126_high_4
Description: NF16126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16126_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 87 - 238
Target Start/End: Complemental strand, 40960211 - 40960061
Alignment:
| Q |
87 |
actaaaggctccgacgaataaatgaaagtatgttccaaaagtaggaaaattctaatattatgccttaagaaattaaatgtgaaactattgttttgaaaag |
186 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40960211 |
actaaaggctccgacgaacaaatgaaagtatgttccaaaagtaggaaaattctaatattatgccttaagaaattaaatgtgaaactattgttttgaaaag |
40960112 |
T |
 |
| Q |
187 |
tgacttcaataccactaaatttttaaaaattatactttccaacaatagattg |
238 |
Q |
| |
|
||||||||||||| ||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
40960111 |
tgacttcaatacctctaaa-tttaaaaaattatactttccaacaatagattg |
40960061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 13 - 87
Target Start/End: Complemental strand, 40960351 - 40960275
Alignment:
| Q |
13 |
gcaaagggaccggcctgatgaagactata--aagtcttattacggaaacagagaaacatcaatggtagcacaaggga |
87 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40960351 |
gcaaagggaccggcctgatgaagactatataaagtcttattacggaaacagagaaacatcaatggtagcacaaggga |
40960275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University