View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16126_high_6 (Length: 245)
Name: NF16126_high_6
Description: NF16126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16126_high_6 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 108 - 245
Target Start/End: Complemental strand, 42616773 - 42616636
Alignment:
| Q |
108 |
cactaattaatttacagatgaagtgaagtatcaacatccgaggtatcaaaatttcttgatgttgatgatgcaccttgtgaccatggactcaaagatgtgt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42616773 |
cactaattaatttacagatgaagtgaagtatcaacatctgaggtatcaaaatttcttgatgttgatgatgcaccttgtgaccatggactcaaagatgtgt |
42616674 |
T |
 |
| Q |
208 |
ttgatttcatggtgcttttatcaccttgcttgcttgtc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42616673 |
ttgatttcatggtgcttttatcaccttgcttgcttgtc |
42616636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 11 - 46
Target Start/End: Complemental strand, 42616870 - 42616835
Alignment:
| Q |
11 |
cataggaaactggtatatgcacatatacacaaacac |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
42616870 |
cataggaaactggtatatgcacatatacacaaacac |
42616835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University