View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16129_low_6 (Length: 244)
Name: NF16129_low_6
Description: NF16129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16129_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 14 - 238
Target Start/End: Complemental strand, 39244421 - 39244197
Alignment:
| Q |
14 |
atcatcatatgctacaacaaccttgagcatgggaaattttttgagtacttttcttctatcaaatgttgcccgtctcacaagtaaacatggtcataaaggt |
113 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39244421 |
atcatcatatgctacaacatccttgagcatgggaaattttttgagtacttttcttctatcaaatgttgctcgtctcacaagtaaacatggtcataaaggt |
39244322 |
T |
|
| Q |
114 |
tggattttagataatctaaatatctcacatttagattattattatgcttttttggccttgttaagtgttgtcaacttctttttctttcttattatcgcca |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39244321 |
tggattttagataatctaaatatctcacatttagattattattatgcttttttggccttgttaagtgttgtcaacttctttttctttcttattattgcca |
39244222 |
T |
|
| Q |
214 |
aattctttgtatataatgatgatgt |
238 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
39244221 |
aattctttgtatataatgatgatgt |
39244197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 28 - 238
Target Start/End: Complemental strand, 39250344 - 39250134
Alignment:
| Q |
28 |
caacaaccttgagcatgggaaattttttgagtacttttcttctatcaaatgttgcccgtctcacaagtaaacatggtcataaaggttggattttagataa |
127 |
Q |
| |
|
|||||||| | ||||||||||||| ||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39250344 |
caacaaccattagcatgggaaattacttgagtacttttcttttatcaaatgttgctcgtctcacaagtaaacatggtcataaaggttggattttggataa |
39250245 |
T |
|
| Q |
128 |
tctaaatatctcacatttagattattattatgcttttttggccttgttaagtgttgtcaacttctttttctttcttattatcgccaaattctttgtatat |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
39250244 |
tctaaatatctcacatttagattattattatgcttttttggccttgataagtgttgtcaacttctttttctttcttgttattgccaaattctttgtatat |
39250145 |
T |
|
| Q |
228 |
aatgatgatgt |
238 |
Q |
| |
|
||||||||||| |
|
|
| T |
39250144 |
aatgatgatgt |
39250134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 16 - 238
Target Start/End: Complemental strand, 39259842 - 39259620
Alignment:
| Q |
16 |
catcatatgctacaacaaccttgagcatgggaaattttttgagtacttttcttctatcaaatgttgcccgtctcacaagtaaacatggtcataaaggttg |
115 |
Q |
| |
|
||||||| || |||||||| |||||||| || |||||||||||||||||||||||||||| |||||| ||||||||||||| |||||||||| ||||| |
|
|
| T |
39259842 |
catcatacgccacaacaactttgagcattgggaattttttgagtacttttcttctatcaattgttgctgatctcacaagtaaaaatggtcataagggttg |
39259743 |
T |
|
| Q |
116 |
gattttagataatctaaatatctcacatttagattattattatgcttttttggccttgttaagtgttgtcaacttctttttctttcttattatcgccaaa |
215 |
Q |
| |
|
|||||| ||||||||||| |||| | | |||||||||||||||| |||||||||||||| |||| |||||| ||| ||| ||| || |||| |||||| |
|
|
| T |
39259742 |
gattttgaataatctaaatgtctcgcgtatagattattattatgcatttttggccttgttgagtgctgtcaatttcatttgcttctttgttattgccaaa |
39259643 |
T |
|
| Q |
216 |
ttctttgtatataatgatgatgt |
238 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
39259642 |
ttctttgtatataatgatgatgt |
39259620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 98 - 163
Target Start/End: Complemental strand, 39256508 - 39256443
Alignment:
| Q |
98 |
acatggtcataaaggttggattttagataatctaaatatctcacatttagattattattatgcttt |
163 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||| ||||| | ||||||||| ||||||||||| |
|
|
| T |
39256508 |
acatggtcacaaaggttggattttgaataatctaaacatctctcgtttagattactattatgcttt |
39256443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 98 - 158
Target Start/End: Complemental strand, 39222872 - 39222812
Alignment:
| Q |
98 |
acatggtcataaaggttggattttagataatctaaatatctcacatttagattattattat |
158 |
Q |
| |
|
||||||||| ||||||||| |||| ||||| ||||| ||||| | |||||||||||||||| |
|
|
| T |
39222872 |
acatggtcacaaaggttgggttttggataacctaaacatctctcgtttagattattattat |
39222812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University