View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16129_low_7 (Length: 241)
Name: NF16129_low_7
Description: NF16129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16129_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 105 - 221
Target Start/End: Original strand, 3482847 - 3482964
Alignment:
| Q |
105 |
gaacctttcccggaaagaaaatcagtccaataaagcccaattggataagtggggctctttagcccccatttttgcgggaaaaaaa-cctatttgatcgaa |
203 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3482847 |
gaacctttccctgaaagaaaatcagtccaataaagcccaattggataagtggggctctttagcccccatttttgcgggaaaaaaaccctatttgatcgaa |
3482946 |
T |
 |
| Q |
204 |
atgtatcttatgatgatg |
221 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
3482947 |
atgtatcttatgatgatg |
3482964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 3482773 - 3482843
Alignment:
| Q |
1 |
gtaacttttgatcggctttttcataaatgtcaccaattatga-ggggtctattgaacaatcatgttcttct |
70 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3482773 |
gtaatttttaatcggctttttcataaatgtcaccaattatgagggggtctattgaacaatcatgttcttct |
3482843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University