View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1612_low_13 (Length: 202)
Name: NF1612_low_13
Description: NF1612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1612_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 15 - 188
Target Start/End: Original strand, 3375569 - 3375738
Alignment:
| Q |
15 |
cataggaaatatttaagcaaggatggatatacaaaaataaagttttgcttgctaatctatagcttgatgagatcatcgttaagcaaatacgttgtattta |
114 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3375569 |
cataggaaatatttaagcaaggat----atacaaaaataaagttttgcttgctaatctatagcttgatgagatcatcgttaagcaaatacgttgtattta |
3375664 |
T |
 |
| Q |
115 |
taatgtgctgtgcgttggcatcaatcaatattctacatctgaaagtgttcacacgtcacttcattcgcataatt |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3375665 |
taatgtgctgtgcgttggcatcaatcaatattctacatctgaaagtgttcacacgtcacttcattagcataatt |
3375738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 15 - 72
Target Start/End: Original strand, 3350163 - 3350220
Alignment:
| Q |
15 |
cataggaaatatttaagcaaggatggatatacaaaaataaagttttgcttgctaatct |
72 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3350163 |
cataggaaatatttaagcaaggttggatatacaaaaataaagttttgcttgctaatct |
3350220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University