View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1612_low_6 (Length: 294)
Name: NF1612_low_6
Description: NF1612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1612_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 20 - 289
Target Start/End: Original strand, 13143899 - 13144168
Alignment:
| Q |
20 |
gtgttcgtgatagggtattaatctaccaattaggcaatgagaactcccgaattacactggctcacccaccacattctcttcaatttccaagaaaggtggt |
119 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
13143899 |
gtgttcgtgatagggtattaatctgtcaattaggcaatgagaactcccgaattacactggctcacccaccacattctcttcaatttccaaaaaaagtggt |
13143998 |
T |
 |
| Q |
120 |
aaacattcgacgtggtttaccgattcaagagccaaacgacacattaaagacgctttttgagagacatatgcagattgtcacacctaactttaacaacaaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13143999 |
aaacattcgacgtggtttaccgattcaagagcgaaacgacacattgaagacgctttttgagagacatatgcagattgtcacacctaactttaacaacaaa |
13144098 |
T |
 |
| Q |
220 |
atggttcacaattggagggcccataattactcacaggatcaattgttgtttggttcactagtgccctatg |
289 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
13144099 |
atggttcacaattggagggcccgtaattactcacaggatcaattgttgtttggttcaccaatgccctatg |
13144168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University