View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1612_low_9 (Length: 237)
Name: NF1612_low_9
Description: NF1612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1612_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 3 - 226
Target Start/End: Complemental strand, 8351748 - 8351526
Alignment:
| Q |
3 |
gcgaacctaattcctatcatgggacgtggttgtaggcatgatttggaggggaacccaaagacggatgcgtcccaggttgttgacccttcttaagactagt |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| ||||| ||||||| |
|
|
| T |
8351748 |
gcgaacctaattcctatcatgggacgtggttgtaggcatgatttggaggggaacccacagacggatgcgtcccaggttgttaacccatctta-gactagt |
8351650 |
T |
|
| Q |
103 |
actatgtgactactcaggaggagtgcaaccaggctgagaagcatcacgaggaggttcagcctgagcgacacgacgcatcacagccccaccaccaattgat |
202 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
8351649 |
actatgtgactactcgggaggagtacaaccaggctgagaagcatcacgaggaggttcagcctgagcgacacgacgcatcgcagccccaccaccaactgat |
8351550 |
T |
|
| Q |
203 |
gcttttactaggggacatgatgat |
226 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
8351549 |
gcttttactaggggacatgatgat |
8351526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 23 - 113
Target Start/End: Original strand, 25222572 - 25222662
Alignment:
| Q |
23 |
gggacgtggttgtaggcatgatttggaggggaacccaaagacggatgcgtcccaggttgttgacccttcttaagactagtactatgtgact |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | || | |||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25222572 |
gggacgtggttgtaggcatgatttggaggggacctcacatgcggatgtgtctcaggttgttgacccttcttaagactagtactatgtgact |
25222662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 130 - 223
Target Start/End: Original strand, 25222723 - 25222816
Alignment:
| Q |
130 |
accaggctgagaagcatcacgaggaggttcagcctgagcgacacgacgcatcacagccccaccaccaattgatgcttttactaggggacatgat |
223 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| | || | ||| |||| ||||||||||| ||||||| |||| ||||||| |||| |
|
|
| T |
25222723 |
accaggctgagcagcatcacgaggaggttcagcctgagtggcatcatgcaccacacccccaccaccacttgatgcctttatcaggggacctgat |
25222816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University