View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16130_high_2 (Length: 315)
Name: NF16130_high_2
Description: NF16130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16130_high_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 11 - 298
Target Start/End: Original strand, 3238630 - 3238917
Alignment:
| Q |
11 |
caaaggatagataaattaccaaaaatttgggatatgtacttaaaacttttgtagatccctttaatcgtcatggtggaatcacaaacccaagctcaatatg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3238630 |
caaaggatagataaattaccaaaaatttgggatatgtacttaaaacttttgtagatccctttaatcgtcatggtggaatcacaaacccaagctcaatatg |
3238729 |
T |
|
| Q |
111 |
gtagcctattagaatggcaaaatgtagaagcaaaaatcctaattttaatgcttttgttgcctgtcacaatatgaatatgcatgattaaactttggtcatn |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3238730 |
gtagcctattagaatggcaaaatgtagaagcaaaaatcctaattttaatgcttttgttgcctgtcacaatatgaatatgcatgattaaactttggtcata |
3238829 |
T |
|
| Q |
211 |
nnnnnntgaataattaaatattgtacacaattatgaattcaataaaagggatgagttcaatgcatgtgatttaagaggaacctttcct |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3238830 |
aaaaaatgaataattaaatattgtacacaattatgaattcaataaaagggattagttcaatgcatgtgatttaagaggaacctttcct |
3238917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University