View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16130_high_5 (Length: 217)
Name: NF16130_high_5
Description: NF16130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16130_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 15 - 202
Target Start/End: Complemental strand, 50594138 - 50593951
Alignment:
| Q |
15 |
gtgagaagaagagttaaagctcttcctagtggattgtttaagtatttactataccatccaacatttgatttcggttttggaacaaaaacttcgtcgcgtt |
114 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
50594138 |
gtgataagaagagttaaagctcttcctagtggattgtttaagtatttactataccatccaacatttgatttaggttttggaacaaaaacttcgtcgcgtt |
50594039 |
T |
|
| Q |
115 |
caagagaagctgtgttcgaatggtgtcggcgatgactgattttccatgagaaatatggaactaaaagtgaagtgtgtagtatgaaacc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50594038 |
caagagaagctgtgttcgaatggtgtcggcgatgactgattttccatgagaaatatggaactaaaagtgaagtgtgtagtatgaaacc |
50593951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 93 - 151
Target Start/End: Complemental strand, 23031281 - 23031223
Alignment:
| Q |
93 |
ggaacaaaaacttcgtcgcgttcaagagaagctgtgttcgaatggtgtcggcgatgact |
151 |
Q |
| |
|
||||||||||| || |||||||| |||||| ||||||| || ||||| ||||||||||| |
|
|
| T |
23031281 |
ggaacaaaaacctcatcgcgttcgagagaacctgtgttagagtggtggcggcgatgact |
23031223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University