View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16131_high_35 (Length: 216)
Name: NF16131_high_35
Description: NF16131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16131_high_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 4008254 - 4008452
Alignment:
| Q |
1 |
caaacagtttcaggagctgaagcacaagatgtgaagttgaagtcaaaatatggtttattttgttcgtctccacttgttcaacacgcagaaatttcggcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4008254 |
caaacagtttcaggagctgaagcacaagatgtgaagttgaagtcaaaatatggtttattttgttcgtctccacttgttcaacacgcagaaatttcggcca |
4008353 |
T |
|
| Q |
101 |
aaaggatgccgaactcttattgactgcaagacatagatgctaaattgaactgggtaatgattgagcaatttagcttctttagtttgtagcacaataggt |
199 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4008354 |
aaaggatgctgaactcttattgactgcaagacatagatgctaaattgaactgggtaatgattgagcaatttagcttctttagtttgtagcacaataggt |
4008452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University