View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16131_low_29 (Length: 262)
Name: NF16131_low_29
Description: NF16131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16131_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 33 - 244
Target Start/End: Complemental strand, 36691354 - 36691143
Alignment:
| Q |
33 |
cataggatctggaaagaaggatgtttatgattttggttgtttgctttttgagctgattaaggggaagaaatttggccaaacaagtgattgtttaagtaat |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36691354 |
cataggatctggaaagaaggatgtttatgattttggttgtttgctttttgagctgattaaggggaagaaatttggccaaacaagtgattgtttaagtaat |
36691255 |
T |
 |
| Q |
133 |
actaatgttccgtttgcgacctacacatattccaatcctatgaatctgttggaggaccattttgggttctatgatgcagtgaatgaatctctaaacaaga |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36691254 |
actaatgttccgtttgcgacctacacatatcctaatcctatgaatctgttggaggaccattttgggttctatgatgcagtgaatgaatctctaaacaaga |
36691155 |
T |
 |
| Q |
233 |
tagaatttgaag |
244 |
Q |
| |
|
|||||||||||| |
|
|
| T |
36691154 |
tagaatttgaag |
36691143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 3e-17; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 46 - 107
Target Start/End: Complemental strand, 23655025 - 23654964
Alignment:
| Q |
46 |
aagaaggatgtttatgattttggttgtttgctttttgagctgattaaggggaagaaatttgg |
107 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
23655025 |
aagaaggatgtttctgactttggttgtttgctttttgagctgattaatgggaataaatttgg |
23654964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 46 - 107
Target Start/End: Original strand, 23803545 - 23803606
Alignment:
| Q |
46 |
aagaaggatgtttatgattttggttgtttgctttttgagctgattaaggggaagaaatttgg |
107 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
23803545 |
aagaaggatgtttctgactttggttgtttgctttttgagctgattaatgggaataaatttgg |
23803606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 199 - 240
Target Start/End: Complemental strand, 23654875 - 23654834
Alignment:
| Q |
199 |
ttctatgatgcagtgaatgaatctctaaacaagatagaattt |
240 |
Q |
| |
|
|||| |||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
23654875 |
ttctgtgatgcagtggatgaatatctaaacaagatagaattt |
23654834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 199 - 240
Target Start/End: Original strand, 23803695 - 23803736
Alignment:
| Q |
199 |
ttctatgatgcagtgaatgaatctctaaacaagatagaattt |
240 |
Q |
| |
|
|||| |||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
23803695 |
ttctgtgatgcagtggatgaatatctaaacaagatagaattt |
23803736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University