View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16131_low_36 (Length: 233)

Name: NF16131_low_36
Description: NF16131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16131_low_36
NF16131_low_36
[»] chr8 (2 HSPs)
chr8 (15-215)||(32703526-32703728)
chr8 (161-210)||(32627381-32627430)
[»] chr6 (1 HSPs)
chr6 (19-134)||(21943190-21943305)
[»] chr3 (1 HSPs)
chr3 (37-134)||(27736355-27736452)
[»] chr4 (1 HSPs)
chr4 (19-137)||(5811079-5811197)


Alignment Details
Target: chr8 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 15 - 215
Target Start/End: Complemental strand, 32703728 - 32703526
Alignment:
15 caaaggcaatatttacttgg-ccagcacaagcccctcaagtgtcattaaggcttactatgaaaaatttagaaaagatttctcattttttctaaaatgtcg 113  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||    
32703728 caaaggcaatatttacttgggccagcacaagcccctcaagtgtcattaaggcttactatgaacaatatagaaaagatttctcattttttctaaaatgtcg 32703629  T
114 tgccctagagttagttgaaggtgggatcctgattcttactattatttg-aagaaaaagcgaagatccatcaagcaaagagtgttgttacgtttgggaagt 212  Q
    |||||||||||||||||||||||||| |||| |||||||| ||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||    
32703628 tgccctagagttagttgaaggtgggagcctggttcttacttttattggaaagaaaaagcgaagatccatcaagcaaagagtgttgttacgtttgggaagt 32703529  T
213 tat 215  Q
    |||    
32703528 tat 32703526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 161 - 210
Target Start/End: Complemental strand, 32627430 - 32627381
Alignment:
161 gaagaaaaagcgaagatccatcaagcaaagagtgttgttacgtttgggaa 210  Q
    |||||||||||||  ||||| ||||||| |||||||||||| ||||||||    
32627430 gaagaaaaagcgacaatccaacaagcaaggagtgttgttacatttgggaa 32627381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 19 - 134
Target Start/End: Complemental strand, 21943305 - 21943190
Alignment:
19 ggcaatatttacttggccagcacaagcccctcaagtgtcattaaggcttactatgaaaaatttagaaaagatttctcattttttctaaaatgtcgtgccc 118  Q
    ||||| ||||||||||| | |||||||||||||| |||| | ||||||||||||||  |||||   | |||||| ||  |||||||||| ||||||||||    
21943305 ggcaacatttacttggcgaccacaagcccctcaaatgtcttcaaggcttactatgagcaatttcatagagatttatctctttttctaaagtgtcgtgccc 21943206  T
119 tagagttagttgaagg 134  Q
     |||  ||||||||||    
21943205 aagaactagttgaagg 21943190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 37 - 134
Target Start/End: Complemental strand, 27736452 - 27736355
Alignment:
37 agcacaagcccctcaagtgtcattaaggcttactatgaaaaatttagaaaagatttctcattttttctaaaatgtcgtgccctagagttagttgaagg 134  Q
    ||||||||||||||||  ||||| |||||||||||  |  ||||| ||| ||||||||| ||||||||   ||||||||||  ||| |||||||||||    
27736452 agcacaagcccctcaaacgtcatcaaggcttactacaagcaatttcgaacagatttctctttttttcttcgatgtcgtgccaaagaattagttgaagg 27736355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 137
Target Start/End: Complemental strand, 5811197 - 5811079
Alignment:
19 ggcaatatttacttggccagcacaagcccctcaagtgtcattaaggcttactatgaaaaatttagaaaagatttctcattttttctaaaatgtcgtgccc 118  Q
    ||||| |||||| || | |||||||||||||||| ||||   |||||||||||  |  |||||  || ||||||||| |||||||| || |||||||||     
5811197 ggcaacatttacctgacgagcacaagcccctcaaatgtccacaaggcttactacaagcaatttcaaacagatttctctttttttctcaagtgtcgtgccg 5811098  T
119 tagagttagttgaaggtgg 137  Q
     |||  |||||||||||||    
5811097 aagaactagttgaaggtgg 5811079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University