View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16131_low_6 (Length: 508)
Name: NF16131_low_6
Description: NF16131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16131_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 145 - 501
Target Start/End: Original strand, 52471832 - 52472188
Alignment:
| Q |
145 |
tggaccgtaaatgcaaaagagtcttctaatggttaccttttggtatcccataaattaaacaacgttgacagccaaggatctgtgttagaaatgaaggttc |
244 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
52471832 |
tggaccgtaaatgcaaaagagtcttctaaaggttaccttttggtatcccataaattaaacaatgttgaaagccaaggatctgtgttagaaatgaaggaga |
52471931 |
T |
|
| Q |
245 |
aggatatggtccaagtgttggattgaggcccttggaagcccaacattgggagagaatataggctgagtgtggtggtacagtgagacgtgttttgtgatct |
344 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52471932 |
acacaatggtccaagtgttggattgaggcccttggaagcccaacattgggagagaatataggctgagtgtggtggtacagtgagacgtgttttgtgatct |
52472031 |
T |
|
| Q |
345 |
cttttaacaccgtatagtaactgtcatgtctgcttgctgctgtttagacagaaactcacccttcttttgttagccaatttaaaaccccatccttcttagt |
444 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52472032 |
cttttaacaccgtatagtaactgtcatgtctgcttgctgctgtttagacagaaactcacccttcttttgttagccaatttaaaaccccatccttcttagt |
52472131 |
T |
|
| Q |
445 |
aacaccattcagcaaggtatagaaggaggcagtctcacccgtcgattgttgcctatg |
501 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
52472132 |
aacaccattcagcaaggtatagaaggaggcagtctcatccgtcgattgttgcctatg |
52472188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 163 - 212
Target Start/End: Complemental strand, 38794036 - 38793987
Alignment:
| Q |
163 |
gagtcttctaatggttaccttttggtatcccataaattaaacaacgttga |
212 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||| || ||| ||||| |
|
|
| T |
38794036 |
gagtcctctaatggttaccttttggtatcgcataaatcaatcaatgttga |
38793987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University