View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16132_high_7 (Length: 252)
Name: NF16132_high_7
Description: NF16132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16132_high_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 10 - 197
Target Start/End: Original strand, 27643943 - 27644130
Alignment:
| Q |
10 |
gcagagatgttgttgttgtcgcaatgttgctgttataatatcctcgcaacattgcagcgcgattttcaatcatgtgtacagccggattgtgaccaaatca |
109 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
27643943 |
gcagagatgttgttcttgtcgcaatgttgctgttataatatcctcgcaacattgcagtgtgattttcaatcatgcgtacaaccggattgtgaccaaatca |
27644042 |
T |
|
| Q |
110 |
tgaaccacatcagaggatttcagccattttggttcaaatcttcacactattaaactgtaatgagcgcaatcacatccgtgaccgcaat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
27644043 |
tgaaccacatcagaggatttcagccattttggttcaaatcttcacactattaaactgtaatgagcacaatcacatctgtgaccgcaat |
27644130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University