View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16132_low_11 (Length: 224)
Name: NF16132_low_11
Description: NF16132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16132_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 111 - 209
Target Start/End: Complemental strand, 53033464 - 53033365
Alignment:
| Q |
111 |
ttatcttgggaaagttactagcaagtgccaaa-gtgtcttgcatatatttttcttttgaaggaaacaacgatgatagttaaacaccttaacttcttaatt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53033464 |
ttatcttgggaaagttactagcaagtgccaaaagtgtcttgcatatatttttcttttgaaggaaacaacgatgatagttaaacaccttaacttcttaatt |
53033365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 30 - 81
Target Start/End: Complemental strand, 53033522 - 53033471
Alignment:
| Q |
30 |
actgcatgcataataacagtgcagatcagaaataggataaagtcacagcaaa |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
53033522 |
actgcatgcataataacagtgcagatcagaaataggataaagtcaccgcaaa |
53033471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University