View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16133_high_12 (Length: 237)
Name: NF16133_high_12
Description: NF16133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16133_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 73 - 221
Target Start/End: Complemental strand, 44816935 - 44816787
Alignment:
| Q |
73 |
tacaataactttattacccagccacgttttttagtttattccataagtcatcttcgtcttctgatttctctggttcttctgtgactgttgctgttggact |
172 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44816935 |
tacaataacattattacccagccacgttttttagtttattccataagtcatcttcgtcttctgatttctctggttcttctgtgactgttgctgttggact |
44816836 |
T |
 |
| Q |
173 |
ttcggccatttgaactgcaggactttccttacttccggctgcagaagat |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44816835 |
ttcggccatttgaactgcaggactttccttacttccggctgcagaagat |
44816787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 44817007 - 44816962
Alignment:
| Q |
1 |
agatagagttcataattaatgaaaactggttgctctacagatttat |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44817007 |
agatagagttcataattaatgaaaactggttgctctacacatttat |
44816962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University