View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16133_high_5 (Length: 383)
Name: NF16133_high_5
Description: NF16133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16133_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 243; Significance: 1e-134; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 13 - 363
Target Start/End: Original strand, 8337044 - 8337396
Alignment:
| Q |
13 |
attatactctccataagtagataatttgaaatttatataacgtatatttggtaatgtaatt----gttaatggannnnnnnnnnnnnngaggaaaattgt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
8337044 |
attatactctccataagtagataatttgaaatttatataacgtatatttggtaatgtaattaattgttaatgg--tttttttttttttgaggaaaattgt |
8337141 |
T |
 |
| Q |
109 |
taatggaaatgattctcgagatactttatattttagatgctatggtatatgataaaatcaaattatannnnnnngctttaaatcatttttcatcattttg |
208 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
8337142 |
taatggaaatgattctcgagatattttatattttagatgttatggtatatgataaaatcaaattatatttttttgctttaaatcatttttcattattttg |
8337241 |
T |
 |
| Q |
209 |
atttaatattctcgagaaaaaattattctcaagagattttatattttagaagttatggtaaatagtaaaatcaaaatcaaatttgatgttttgaatcata |
308 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8337242 |
atttaatattctcgagaaaaaatgattctcaagagattttatattttagaagttatggtaaatagtaaaatcaaaatcaaatttgatgttttgaatcatt |
8337341 |
T |
 |
| Q |
309 |
tttcattatttccatttaatgcaaaatatcccttcacaaagactatgctagacac |
363 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8337342 |
tttcattatttccatttaatgcaaaatatcccttcacaaagactatgctatacac |
8337396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University