View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16133_high_8 (Length: 315)
Name: NF16133_high_8
Description: NF16133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16133_high_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 1 - 299
Target Start/End: Complemental strand, 980478 - 980180
Alignment:
| Q |
1 |
taattggtttgaggacttgaactttccacttctaggctaaagttttaaatcacttgcccgaagatcaaaaatccgcagctgagtctagtgccttttcaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
980478 |
taattggtttgaggacttgaactttccacttctaggctaaagttttaaatcacttgcccgaagatcaaaaatccgcagctgagtctagtgccttttcaac |
980379 |
T |
 |
| Q |
101 |
aatgtatgctaatccatatgatgcaattggaaaagtatttggacctgagcgctcgggtcgtgttcgaggtttgggaattgggatatccccttctagaaag |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
980378 |
aatgtatgctaatccatacgatgcaattggaaaagtatttggacctgagcgctcgggtcgtgttcgaggtttgggaattgggatatccccttctagaaag |
980279 |
T |
 |
| Q |
201 |
ttcggaccagatgtctgtttaaaggtattcgaccaagatttttctctgtgtgacctaagtttcaattttcaatgtcattttgtttgcttcaagtgattt |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
980278 |
ttcggaccagatgtctgtttaaaggtattcgaccaagatttttctttgtgtgacctatgtttcaattttcaatgtcattttgtttgcttcaagtgattt |
980180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 1 - 168
Target Start/End: Complemental strand, 27146592 - 27146425
Alignment:
| Q |
1 |
taattggtttgaggacttgaactttccacttctaggctaaagttttaaatcacttgcccgaagatcaaaaatccgcagctgagtctagtgccttttcaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27146592 |
taattggtttgaggacttgaactttccacttctaggctaaagttttaaatcacttgcccgaagatcaaaaatccgcagttgagtctagtgccttttcaac |
27146493 |
T |
 |
| Q |
101 |
aatgtatgctaatccatatgatgcaattggaaaagtatttggacctgagcgctcgggtcgtgttcgag |
168 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27146492 |
aatgtatgctaatccatacgatgcaattggaaaagtatttggacctgagcgctcgggtcgtgttcgag |
27146425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University