View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16133_low_4 (Length: 432)
Name: NF16133_low_4
Description: NF16133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16133_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 408; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 408; E-Value: 0
Query Start/End: Original strand, 7 - 414
Target Start/End: Complemental strand, 36575168 - 36574761
Alignment:
| Q |
7 |
gattattctctatatgtatattggttcaggtggacctaattggaggttattatgatgctggtgataaccttaagtttgggcttccaatggcttttactac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36575168 |
gattattctctatatgtatattggttcaggtggacctaattggaggttattatgatgctggtgataaccttaagtttgggcttccaatggcttttactac |
36575069 |
T |
|
| Q |
107 |
aacattattagcatggagtgtcattgaatttggaagctcaatgcaggaccagattgacaatgctagagctgctatccggtggagtaccgattaccttctc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36575068 |
aacattattagcatggagtgtcattgaatttggaagctcaatgcaggaccagattgacaatgctagagctgctatccggtggagtaccgattaccttctc |
36574969 |
T |
|
| Q |
207 |
aaagccgccaccacgactccagacacgttatacgtccaagtgagtggccgctctgagaatgttttgggtgcgcgatcacacattttattagttaaaaaat |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36574968 |
aaagccgccaccacgactccagacacgttatacgtccaagtgagtggccgctctgagaatgttttgggtgcgcgatcacacattttattagttaaaaaat |
36574869 |
T |
|
| Q |
307 |
tgtttctaaatatcctaaatatttgcaggttggagagccgaacatggatcacaggtgttgggaaaggccggaggacatggacactccacgcaatgtgtat |
406 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36574868 |
tgtttctaaatatcctaaatatttgcaggttggagagccgaacatggatcacaggtgttgggaaaggccggaggacatggacactccacgcaatgtgtat |
36574769 |
T |
|
| Q |
407 |
aaggtctc |
414 |
Q |
| |
|
|||||||| |
|
|
| T |
36574768 |
aaggtctc |
36574761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 46 - 106
Target Start/End: Complemental strand, 39419629 - 39419569
Alignment:
| Q |
46 |
ttggaggttattatgatgctggtgataaccttaagtttgggcttccaatggcttttactac |
106 |
Q |
| |
|
||||||| ||||||||||||||||| || | |||||||| |||| |||||||||||||| |
|
|
| T |
39419629 |
ttggagggtattatgatgctggtgacaatgtcaagtttggttttcctatggcttttactac |
39419569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University