View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16134_high_7 (Length: 229)
Name: NF16134_high_7
Description: NF16134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16134_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 49 - 213
Target Start/End: Complemental strand, 47287005 - 47286841
Alignment:
| Q |
49 |
ccctctagcaatcaaggagaatgggaactaatacaaccaaccattggcatttcagctatgcacatgcaactttcacacaacaataaaatcataattttcg |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47287005 |
ccctctagcaatcaaggagaatgggaactaatacaaccaaccattggcatttcagctatgcacatgcaactttcacacaacaataaaatcataattttcg |
47286906 |
T |
 |
| Q |
149 |
atcgaaccgattttggcccttcaaatctccctctttcaaatggccggtgtcgtatggatccattc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47286905 |
atcgaaccgattttggcccttcaaatctccctctttcaaatggccggtgtcgtatggatccattc |
47286841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University