View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16134_low_11 (Length: 216)
Name: NF16134_low_11
Description: NF16134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16134_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 11 - 199
Target Start/End: Complemental strand, 44706484 - 44706296
Alignment:
| Q |
11 |
gagatgaatgaaaaatttcaggtttctgaaaaaacaaagtctgtttatgcggttgctgagcaaaaggcaagtgatgctggatctgcaatcatgagcaatc |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44706484 |
gagatggatgaaaaatttcaggtttctgaaaaaacaaagtctgtttatgcggttgctgagcaaaaggcaagtgatgctggatctgcaatcatgagcaatc |
44706385 |
T |
 |
| Q |
111 |
cttatgtatcaaccggagcttcgtgggtgtcgagcgcaattgctgttgttgcaaaagcagctgaagatgtaaccacaatgaccatggag |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44706384 |
cttatgtatcaaccggagcttcgtgggtgtcgagtgcaattactgttgttgcaaaagcagctgaagatgtaaccacaatgaccatggag |
44706296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 11 - 199
Target Start/End: Complemental strand, 11763387 - 11763199
Alignment:
| Q |
11 |
gagatgaatgaaaaatttcaggtttctgaaaaaacaaagtctgtttatgcggttgctgagcaaaaggcaagtgatgctggatctgcaatcatgagcaatc |
110 |
Q |
| |
|
|||||| |||||| | |||| ||||||||| |||||||||| | ||| ||||||||||||||||||||| ||||||||| || |||||||||||| |
|
|
| T |
11763387 |
gagatggatgaaaggtatcagctttctgaaatgacaaagtctgctattgctgttgctgagcaaaaggcaagtagtgctggatccgctatcatgagcaatt |
11763288 |
T |
 |
| Q |
111 |
cttatgtatcaaccggagcttcgtgggtgtcgagcgcaattgctgttgttgcaaaagcagctgaagatgtaaccacaatgaccatggag |
199 |
Q |
| |
|
||||||| | ||| ||||||| ||| ||||||| || || |||||||| || |||||||| ||||| | ||| |||||||||||| |
|
|
| T |
11763287 |
cttatgtcttaactggagctttatggctgtcgagtgcgtttagcgttgttgccaaggcagctgaggatgtcagcacgatgaccatggag |
11763199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University