View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16135_high_12 (Length: 288)
Name: NF16135_high_12
Description: NF16135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16135_high_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 15 - 177
Target Start/End: Complemental strand, 52668435 - 52668273
Alignment:
| Q |
15 |
aaaataaacatttgaaagcaaaagcgtaatttgcacgaagaaagagaaaaatggcagcagaagagggacaagtgatcggagttcacactgtggaggcttg |
114 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
52668435 |
aaaatagacatttgaaagcaaaagcgtaatttgtacgaagaaagaaaaaaatggcagcagaagagggacacgtgatcggagttcacactgtggaggcttg |
52668336 |
T |
|
| Q |
115 |
gaaggaacacctcgagaagggaaatggatccaagaaactggttcgtaattactctcaaaattg |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52668335 |
gaaggaacacctcgagaagggaaatggatccaagaaactggttcgtaattactctcaaaattg |
52668273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 210 - 269
Target Start/End: Complemental strand, 52668228 - 52668169
Alignment:
| Q |
210 |
attcgaaattataaccgcactagggtttttcatttccttagtttagggatctaactgttg |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52668228 |
attcgaaattataaccgcactagggtttttcatttccttagtttagggatctaattgttg |
52668169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University