View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16135_low_15 (Length: 258)
Name: NF16135_low_15
Description: NF16135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16135_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 20 - 252
Target Start/End: Complemental strand, 39173753 - 39173521
Alignment:
| Q |
20 |
atattggtctagatctagtgttgaatttgtaagttttcgatggttatactttgttgttttatgataaaactgatgatgtttcctttagcctctttgcaaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
39173753 |
atattggtctagatctagtgttgaatttgtaagttttcgatggttatacttctttgttttatgataaaactgatgatgtttcctttagcctctttgcgaa |
39173654 |
T |
|
| Q |
120 |
ccttggaagatttgtacacgggaagttccttgtaagtgaggtcatatcttgctaatgttctgattgcatttcttaaccatgagatatattacttttaact |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
39173653 |
ccttggaagatttgtacacgggaagttccttgtaagtgaagtcatatcttgctaatgttctgattgcatttcttaatcatgagatatattactttaaact |
39173554 |
T |
|
| Q |
220 |
ttgtatcataactcagttttcacttcatctcac |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
39173553 |
ttgtatcataactcagttttcacttcatctcac |
39173521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 20 - 178
Target Start/End: Complemental strand, 39169809 - 39169651
Alignment:
| Q |
20 |
atattggtctagatctagtgttgaatttgtaagttttcgatggttatactttgttgttttatgataaaactgatgatgtttcctttagcctctttgcaaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39169809 |
atattggtctagatctagtgttgaatttgtacgttttcgatggttatacttctttgttttatgataaaactgatgatgtttcctttagcctctttgcaaa |
39169710 |
T |
|
| Q |
120 |
ccttggaagatttgtacacgggaagttccttgtaagtgaggtcatatcttgctaatgtt |
178 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
39169709 |
ccttggaagatttgtacacgggaggttccttgtagttgaggtcatatcttgctaatgtt |
39169651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 118 - 192
Target Start/End: Complemental strand, 39178808 - 39178734
Alignment:
| Q |
118 |
aaccttggaagatttgtacacgggaagttccttgtaagtgaggtcatatcttgctaatgttctgattgcatttct |
192 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||| |||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
39178808 |
aaccttggaagatttgtacatgggaggttccttgtacgtgaggacatatcttgctaatgttgtgattgcatttct |
39178734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 210 - 252
Target Start/End: Complemental strand, 39169160 - 39169118
Alignment:
| Q |
210 |
acttttaactttgtatcataactcagttttcacttcatctcac |
252 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39169160 |
acttctaactttgtatcataactcagttttcacttcatctcac |
39169118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University