View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16136_high_2 (Length: 298)
Name: NF16136_high_2
Description: NF16136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16136_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 3e-85; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 90 - 285
Target Start/End: Complemental strand, 4745058 - 4744863
Alignment:
| Q |
90 |
attgtgaaattcgtataaaaatattatatggtgggataagaagcatgtgcagcaatgccacattgaccccgaggttcaccactttcccttaacactttca |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |||| |||| |
|
|
| T |
4745058 |
attgtgaaattcgtataaaaatattatatgatgggataagaagcatgtgcagcaatgccacattgacctcctggttcaccactttccctcaacaacttca |
4744959 |
T |
 |
| Q |
190 |
tgtagccttcttcaccccaacctttaccccaagaattcttaatcaaccaatatttagttccatcttcacttacaccgtaaccaactgcagcaactg |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4744958 |
tgtagccttcttcaccccaacctttaccccaagaattcttaatcaaccaatacttagttccatcttcacttacaccgtaaccaactgcagtaactg |
4744863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 114 - 241
Target Start/End: Complemental strand, 4736523 - 4736396
Alignment:
| Q |
114 |
tatatggtgggataagaagcatgtgcagcaatgccacattgaccccgaggttcaccactttcccttaacactttcatgtagccttcttcaccccaacctt |
213 |
Q |
| |
|
||||| || ||||||| ||||||| ||||||||| ||||||||| | || | ||| ||||||||||| ||| ||||||||||||| |||||||| || |
|
|
| T |
4736523 |
tatatagtaggataagcagcatgtacagcaatgctacattgacctccagttgcactactttcccttagcaccttcatgtagcctttctcaccccatgttt |
4736424 |
T |
 |
| Q |
214 |
taccccaagaattcttaatcaaccaata |
241 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
4736423 |
caccccaagaattcttaatcaaccaata |
4736396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 201 - 241
Target Start/End: Complemental strand, 27349571 - 27349531
Alignment:
| Q |
201 |
tcaccccaacctttaccccaagaattcttaatcaaccaata |
241 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
27349571 |
tcaccccaacctgtaccataagaattcttaatcaaccaata |
27349531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 189 - 253
Target Start/End: Complemental strand, 30892934 - 30892870
Alignment:
| Q |
189 |
atgtagccttcttcaccccaacctttaccccaagaattcttaatcaaccaatatttagttccatc |
253 |
Q |
| |
|
||||| ||||||||||||||| | || ||||| |||||||||| ||||||||| || |||||||| |
|
|
| T |
30892934 |
atgtatccttcttcaccccaatcatttccccatgaattcttaaccaaccaatacttggttccatc |
30892870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 189 - 253
Target Start/End: Original strand, 30719508 - 30719572
Alignment:
| Q |
189 |
atgtagccttcttcaccccaacctttaccccaagaattcttaatcaaccaatatttagttccatc |
253 |
Q |
| |
|
||||| ||||||||||||||| | | ||||| |||||||||| ||||||||| || |||||||| |
|
|
| T |
30719508 |
atgtatccttcttcaccccaatcagttccccatgaattcttaaccaaccaatacttggttccatc |
30719572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 189 - 253
Target Start/End: Complemental strand, 30881851 - 30881787
Alignment:
| Q |
189 |
atgtagccttcttcaccccaacctttaccccaagaattcttaatcaaccaatatttagttccatc |
253 |
Q |
| |
|
||||| ||||||||||||||| | | ||||| |||||||||| ||||||||| || |||||||| |
|
|
| T |
30881851 |
atgtatccttcttcaccccaatcagttccccatgaattcttaaccaaccaatacttggttccatc |
30881787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University