View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16139_high_5 (Length: 250)
Name: NF16139_high_5
Description: NF16139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16139_high_5 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 11 - 250
Target Start/End: Complemental strand, 46095937 - 46095701
Alignment:
| Q |
11 |
caaaggtgcacgtcctagcaaacacgatttcatagtgaaaagatnnnnnnnnnnnnnnncacaagaattacaaaaccatatatataaacatacaaactaa |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46095937 |
caaaggcgcacgtcctagcaaacacgatttcatagtgaaaagataaaaaagaaaaa---cacaagaattacaaaaccatatatataaacatacaaactaa |
46095841 |
T |
|
| Q |
111 |
attgtggaaacttttctgaattaaccggaaaaagtgagaggccgaccttgttaaaagaacactagcagattttatgagtgcagtcccactccctccacca |
210 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46095840 |
attgtggaaacttttctgaattaacaggaaaaagtgagaggccgaccttgttaaaagaacactagcagattttatgagtgcagtcccactccctccacca |
46095741 |
T |
|
| Q |
211 |
cccggtaggatggcagaccgacatacaaaaacactgcacc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46095740 |
cccggtaggatggcagaccgacatacaaaaacactgcacc |
46095701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University