View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16139_low_8 (Length: 253)
Name: NF16139_low_8
Description: NF16139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16139_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 5510173 - 5510409
Alignment:
| Q |
1 |
agcataggagaattggtggaacttgtgactttggtgggactgctatgttgattcattctgatccaagtaagtgcttattaatttgggattaattacaann |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5510173 |
agcataagagaattggtggaacttgtgactttggtgggactgctatgttgattcattctgatccaagtaagtgcttattaatttgggattaattacaatt |
5510272 |
T |
 |
| Q |
101 |
nnnnnaattaacaatgagtgatggttgtgttgtgaattgtatgaaattgtgatagagaaaaaataacttttcattgttactgtgaatgaaaaatcctgct |
200 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5510273 |
tttttaattaacaatgagtgatggttatgttttgaattgtatgaaattgtgatagagaaaaaataacttttcattgttactgtgaatgaaaaatcctgct |
5510372 |
T |
 |
| Q |
201 |
atgtacaataaccataaagaatgtaaccatctaaaac |
237 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5510373 |
atgtacaataaccataaagtatgtaaccatctaaaac |
5510409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University