View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16140_high_9 (Length: 256)

Name: NF16140_high_9

Description: NF16140

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF16140_high_9

[»] chr8 (1 HSPs)

[»] chr2 (1 HSPs)

Target: chr8 (Bit Score: 67; Significance: 7e-30; HSPs: 1)

Name: chr8

Description:

Target: chr8; HSP #1

Raw Score: 67; E-Value: 7e-30

Query Start/End: Original strand, 102 - 232

Target Start/End: Complemental strand, 23891884 - 23891751

Alignment:

Q	102	agaatcaattgaaagcaaaacatataatcaaaattggagtcatagtcttctatcttcgttttgtataatcaccggaggtt---tnnnnnnntcttttgaa	198	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\| \|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|
T	23891884	agaatcaattgaaagcaaaacagatcatcaaaattggagtcatagtcttctatcttcgttttgaataaataccggaggttaaaaaaaaatatcttttgaa	23891785	T

Q	199	ccttctactgtcaatttacacccaattttaaata	232	Q
		\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	23891784	ccttctaatgtcaatttccacccaattttaaata	23891751	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 48; Significance: 2e-18; HSPs: 1)

Name: chr2

Description:

Target: chr2; HSP #1

Raw Score: 48; E-Value: 2e-18

Query Start/End: Original strand, 102 - 157

Target Start/End: Complemental strand, 30801591 - 30801536

Alignment:

Q	102	agaatcaattgaaagcaaaacatataatcaaaattggagtcatagtcttctatctt	157	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	30801591	agaatcaattgaaagcaaaacagatcatcaaaattggagtcatagtcttctatctt	30801536	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]