View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16140_low_7 (Length: 317)
Name: NF16140_low_7
Description: NF16140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16140_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 69 - 300
Target Start/End: Original strand, 37098646 - 37098877
Alignment:
| Q |
69 |
acaccatttccatcactctccgcagcagcaacatcaagaatcctctcaaacaccttcaacaaagcctcctgtgggtttaaagaaacatctccatcgccgt |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37098646 |
acaccatttccatcactctccgcagcagcaacatcaagaatcctctcaaacaccttcaacaaagcctcctgtgggtttaaagaaacatctccatcgccgt |
37098745 |
T |
 |
| Q |
169 |
tgagattaacgatgacaacgataacacgctccggacagtcgaccggcgcgtcgtcgattcggatcctagctccggtgagttgttgaagggatttgatgac |
268 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37098746 |
tgagattaacgatgacaacgatgacacgctccggacagtcgaccggcgcgtcgtcgattcggatcctagctccggtgagttgttgaagggatttgatgac |
37098845 |
T |
 |
| Q |
269 |
ggagccggattttccgatgaaagcgccgatac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37098846 |
ggagccggattttccgatgaaagcgccgatac |
37098877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University