View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16140_low_9 (Length: 256)

Name: NF16140_low_9
Description: NF16140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16140_low_9
NF16140_low_9
[»] chr8 (1 HSPs)
chr8 (102-232)||(23891751-23891884)
[»] chr2 (1 HSPs)
chr2 (102-157)||(30801536-30801591)


Alignment Details
Target: chr8 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 102 - 232
Target Start/End: Complemental strand, 23891884 - 23891751
Alignment:
102 agaatcaattgaaagcaaaacatataatcaaaattggagtcatagtcttctatcttcgttttgtataatcaccggaggtt---tnnnnnnntcttttgaa 198  Q
    |||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| ||||  ||||||||||           |||||||||    
23891884 agaatcaattgaaagcaaaacagatcatcaaaattggagtcatagtcttctatcttcgttttgaataaataccggaggttaaaaaaaaatatcttttgaa 23891785  T
199 ccttctactgtcaatttacacccaattttaaata 232  Q
    ||||||| ||||||||| ||||||||||||||||    
23891784 ccttctaatgtcaatttccacccaattttaaata 23891751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 102 - 157
Target Start/End: Complemental strand, 30801591 - 30801536
Alignment:
102 agaatcaattgaaagcaaaacatataatcaaaattggagtcatagtcttctatctt 157  Q
    |||||||||||||||||||||| || ||||||||||||||||||||||||||||||    
30801591 agaatcaattgaaagcaaaacagatcatcaaaattggagtcatagtcttctatctt 30801536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University