View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16141_high_20 (Length: 291)
Name: NF16141_high_20
Description: NF16141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16141_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 17 - 285
Target Start/End: Complemental strand, 49411589 - 49411314
Alignment:
| Q |
17 |
acctctgaaccttagaaaagggaaacaaacaaaaatcaagcatgcaaacccgaaaccacataatgtaaatagttagaaatcacaaaatgattaagattat |
116 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
49411589 |
acctctgaatcttagaaaagggaaacaaa----aatcaagcatgcaaacccgaaaccacataatgtaaatagctagaaatcacaaaatgattaagattat |
49411494 |
T |
 |
| Q |
117 |
gagtgctttggctaataatatgatattttatcttccttcaacgtcaatttata-----------gcatcatccctagcttccttctaaaagcatctctca |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
49411493 |
gagtgctttggctaataatatgatattttatcttccttcaacatcaatttatagcattatctttgcatcatccctagcttccttctaaaagcatctctca |
49411394 |
T |
 |
| Q |
206 |
tctccaacgatgctatcaccaaacccactttctcttttatgtgcactacttctatgcttacccctagccattcttctcac |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49411393 |
tctccaacgatgctatcaccaaacccactttctcttttatgtgcactacttctatgcttacccctagccattcttttcac |
49411314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University